![EVAg](https://cdn.european-virus-archive.com/sites/default/files/default_images/VirusProduct_381_0.jpg)
- Tagged as
- - Diagnostic reagent
- - Virus
- - Cultivable virus
Produced by
: ERASMUS-MC Shipping From
: Rotterdam - NL
Product Description
Ref-SKU:
011V-00885 Phocine distemper virus to be used for research or as an internal control NAT control
Product Risk Group:
ICTV Taxonomy:
Virus name:
Isolate:
Storage conditions:
Viral Storage Medium -80C
Sequencing:
Complete genome
Infectivity:
Infectivity tested
Mycoplasmic content:
Mycoplasma free
GMO:
No
Biosafety restrictions:
BSL2
Virus host type:
Infectivity Test:
virus culture
Production cell line:
Virus Cultivability:
Passage:
3
Identification technique:
Sequencing and Real Time PCR
Technical recommendation:
The Primer/Probe mix is ready to use 1 µl/reaction.
The PDV Stock can be diluted 1000 times in PBS/DMEM, in our real time PCR assay the Ct-value is approx. Ct28.
For the isolation we use 190 µl plasma or serum, and 10 µl of the diluted PDV (200ul total input volume).
Elution takes place in 100 µl, and 20 µl of this eluate is used for real time PCR assay, Final volume of the real time PCR reaction is 50 µl.
PCR parameters :
Virus: PDV
Target: Haemagglutinine-gen
Product: 78 bp
Reaction conditions: 5 min 50°C, 20 sec 95 °C, 45 cycli ( 3 sec 95°C, 30 sec 60°C)
Sequence 5’-3’
Probe FAM-atgcaagggccaatt-MGB 10 pmol/µl
Primer-fwd cgggtgccttttacaagaac 30 pmol/µl
Primer-rev ttctttcctcaacctcgtcc 7.5 pmol/µl
*This probe is optimized for multiplexing because of its short length; MGB probes are only available at Lifetechnologies, but not with CY5 reporter dye.
ref; Hoek etal, SJID2012, PMID: 22992129.
Cell Culture:
Culture on Vero/ LLCMK2-cells in EMEM medium (Vero/LLCMK2 = monkey kidney cells), continuous cell-line.
(One ampoule Vero-cells is enough for culture flask of 162 cm2 . (Splitratio 1:10 weekly)
EMEM medium containing : - 500 ml EMEM with EBBS (earl’s balance salt solution) BioWhittaker (Cambrex), BESP069F
- 5.7 ml NaHCO3 (7,5%) BioWhittaker (Cambrex) BE17-613E(0.85 g/l 20 mM)
- 10 ml 1M Hepes(20mM)
- 5 ml 200mM L-Glutamine
- 5 ml 10000 U/ml or 10000 µg/ml Penicilline/Streptomycine
- 5 ml Amphotericine in maintenance medium
- 10ml BSA (2%) in maintenance medium
- 1:10.000 diluted Trypsine (Lonza, BE17-160E) in maintenance medium
Culture at 36.5°C for about one week. No CO2 conditions.
PDV virus infection/culture:
Discard the maintenance medium of one monolayer Vero cells culture flask (162 cm2).
Dilute one ampoule (1ml) 1000x concentrated PDV virus stock with 4 ml maintenance medium and apply to the monolayer Vero cells for infection.
Incubate 1 hour at 37°C and remove the virus from the cells.
Add 40 ml maintenance medium and incubate at 37°C.
Check for CPE (measles-like, formation of syncytia) once a week and change medium once a week. If CPE is present, the Ct value of supernatant can be determined with real time PCR.
Culture for as long as needed to obtain a satisfying concentration/stock, the harvest all supernatant, centrifuge to lose cell debris (5 min 1200xg).
Aliquot and store cultured virus at -80°C.
Shipping conditions:
IATA Classification:
Information about the collection of the virus
Biological material origin:
Natural origin
Collection date: BEFORE
Tuesday, 31 December, 2013
Country of collection:
Suspected epidemiological origin :
Isolation host:
Isolation technique:
virus culture
Isolation conditions:
see: Osterhaus ADME & Vedder EJ; Nature (1988) sep 1: 335(6185)20 PMID: 3412456