- Tagged as
- - Derived product
- - Nucleic Acid
- - Viral RNA
- - Diagnostic reagent
Product Description
Information on the related virus
Preparation of SARS-CoV-2 strain 2019-nCoV/Italy-INMI1 RNA
700 ul of RNA was extracted from cell culture supernatant containing SARS-CoV-2 strain 2019-nCoV/Italy-INMI1 grown on Vero E6 cells (viral titer: 10^7.25 TCID50/ml) with the viral RNA mini kit (QIAGEN, Hilden, Germany).
5ul of the extract were tested and quantified by one step real-time RT-PCR using a standard curve prepared through serial dilutions of the Wuhan coronavirus 2019 E gene control (EVAG Ref-SKU: 026N-03866) (Corman et al 2020).
Primers and probe:
E gene E_Sarbeco_F ACAGGTACGTTAATAGTTAATAGCGT
E_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ
E_Sarbeco_R ATATTGCAGCAGTACGCACACA
E gene assay:
Mastermix
H2O RNAse free 3.6 ul
2x Reaction mix 12.5 ul
MgSO4 (50mM) 0.4 ul
Primer Fwd (10uM) 1 ul
Primer Rev (10uM) 1 ul
Probe (10uM) 0.5 ul
SuperScript® III/Platinum® Taq Mix 1 ul
Total volume 20 ul + 5 ul RNA template
Reagents
SuperScript™ III Platinum™ One-Step qRT-PCR Kit Invitrogen SuperScript III OneStep RT-PCR System
RotorGene cycling conditions
55°C 10’
94°C 3’
45 cycles
94°C 15’’
58°C 60’’ single step read F. (530 nm)
The extract was diluited in H2O RNAse free containing Carrier-RNA (Qiagen, C=10 µg/ml) to obtain the final concentration of 10^6 cp/uL (10^5.85 cp/uL).
References:
Corman VM, Landt O, Kaiser M, Molenkamp R, Meijer A, Chu DKW, Bleicker T, Brünink S, Schneider J, Schmidt ML, Mulders DGJC, Haagmans BL, van der Veer B, van den Brink S, Wijsman L, Goderski G, Romette JL, Ellis J, Zambon M, Peiris M, Goossens H, Reusken C, Koopmans MPG, Drosten C. Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. Euro Surveill. 2020 Jan;25(3). doi: 10.2807/1560-7917.ES.2020.25.3.2000045. PubMed PMID: 31992387; PubMed Central PMCID: PMC6988269.